this post was submitted on 03 Oct 2024
25 points (87.9% liked)

Technology

58424 readers
4654 users here now

This is a most excellent place for technology news and articles.


Our Rules


  1. Follow the lemmy.world rules.
  2. Only tech related content.
  3. Be excellent to each another!
  4. Mod approved content bots can post up to 10 articles per day.
  5. Threads asking for personal tech support may be deleted.
  6. Politics threads may be removed.
  7. No memes allowed as posts, OK to post as comments.
  8. Only approved bots from the list below, to ask if your bot can be added please contact us.
  9. Check for duplicates before posting, duplicates may be removed

Approved Bots


founded 1 year ago
MODERATORS
 

Synopsis: Title. Asianometry.

top 5 comments
sorted by: hot top controversial new old
[–] irish_link@lemmy.world 3 points 5 hours ago

The problem is that this has been said since I was in high school and I’m 40. I doubt it will happen in the way we think. It will be some kind of plasma gel instead of humans.

[–] praise_idleness@sh.itjust.works 7 points 8 hours ago

Does this mean that I can back up linux ISOs on my all the time? PCIe connection to my DNA when??

[–] db2@lemmy.world 1 points 9 hours ago (1 children)

GAGGGCTCGCATGCTTGCGAGCCGGCTCGCGTACAAGTGAGCCAGCCGGCTCGCGTGTATACAAGCCGGCTCACAAGTGAGCTTACAAGAGAGATCGAAGACAAGCCGGTATACAAGCCTGCCGGCTCGCGAACAAGCTTGCGCACAAGCGCGTGGGCTCACTCACAAGACGACAAGCTGGCAGGCGAGCGGACAAGCAGACAAGTGAGCCAGCCGGCTCGCGTACAAGTGAGCTTACAAGCGAGCTTACAAGCCGGTGAACAAGCAGACAAGTGTGCCAGCCGGCTAGCGGACAAGCACGCAGGCATGCCTACTAACAAGCTCGCGGGTGCGCGGGTACACAAGTACGCGGGCAGGCTAGCTAGTCGACAAGTGGGTATGCGGGCGAACAAGCCGGTGAACAAACAAGCACGCGGGTCGGCTTGCTCGCGAACAAGTAAGCTAGCAGGTCGGCCGGCTCGCGTACAAGTGTGCCGGTGAGCCAACAAGTGGGCTCGTGAGCCGGCTAACAAGCCCGTGGGTATGTGAACAAGCTCGCTTGTGTACTCAACCAACCGACGGCGCACAAGTCGGCTTGTGGACAAGCATGCAGGCTCACAAGTACGCGGGCAGGCGAACAAGTGAGCCAGCCGGTATACAAGTCGGCTTGTGGACAAGTAAGTACGCTTGCACGCAGGCACGCTAGTCGACAAGTGTGCGGGCAGGTACACAAGCGTGCTAGCAGGTATGTATGCGGGTATACTC

(yes it says something)

[–] toiletobserver@lemmy.world 4 points 8 hours ago (1 children)

Mostly gibberish from the tool i found...

[–] db2@lemmy.world 1 points 4 hours ago

It's not. You won't find a tool.