The problem is that this has been said since I was in high school and I’m 40. I doubt it will happen in the way we think. It will be some kind of plasma gel instead of humans.
Technology
This is a most excellent place for technology news and articles.
Our Rules
- Follow the lemmy.world rules.
- Only tech related content.
- Be excellent to each another!
- Mod approved content bots can post up to 10 articles per day.
- Threads asking for personal tech support may be deleted.
- Politics threads may be removed.
- No memes allowed as posts, OK to post as comments.
- Only approved bots from the list below, to ask if your bot can be added please contact us.
- Check for duplicates before posting, duplicates may be removed
Approved Bots
Does this mean that I can back up linux ISOs on my all the time? PCIe connection to my DNA when??
GAGGGCTCGCATGCTTGCGAGCCGGCTCGCGTACAAGTGAGCCAGCCGGCTCGCGTGTATACAAGCCGGCTCACAAGTGAGCTTACAAGAGAGATCGAAGACAAGCCGGTATACAAGCCTGCCGGCTCGCGAACAAGCTTGCGCACAAGCGCGTGGGCTCACTCACAAGACGACAAGCTGGCAGGCGAGCGGACAAGCAGACAAGTGAGCCAGCCGGCTCGCGTACAAGTGAGCTTACAAGCGAGCTTACAAGCCGGTGAACAAGCAGACAAGTGTGCCAGCCGGCTAGCGGACAAGCACGCAGGCATGCCTACTAACAAGCTCGCGGGTGCGCGGGTACACAAGTACGCGGGCAGGCTAGCTAGTCGACAAGTGGGTATGCGGGCGAACAAGCCGGTGAACAAACAAGCACGCGGGTCGGCTTGCTCGCGAACAAGTAAGCTAGCAGGTCGGCCGGCTCGCGTACAAGTGTGCCGGTGAGCCAACAAGTGGGCTCGTGAGCCGGCTAACAAGCCCGTGGGTATGTGAACAAGCTCGCTTGTGTACTCAACCAACCGACGGCGCACAAGTCGGCTTGTGGACAAGCATGCAGGCTCACAAGTACGCGGGCAGGCGAACAAGTGAGCCAGCCGGTATACAAGTCGGCTTGTGGACAAGTAAGTACGCTTGCACGCAGGCACGCTAGTCGACAAGTGTGCGGGCAGGTACACAAGCGTGCTAGCAGGTATGTATGCGGGTATACTC
(yes it says something)
Mostly gibberish from the tool i found...
It's not. You won't find a tool.